Skip to main content
Figure 10 | BMC Bioinformatics

Figure 10

From: OHMM: a Hidden Markov Model accurately predicting the occupancy of a transcription factor with a self-overlapping binding motif

Figure 10

Gel-shift assays for selected human sites from OHMM predictions. We show the gel-shift results for representative sites out of the OHMM-predicted locations of high NFκB occupancy in human promoters. NFκBIA site is the positive control. Negative control to the bottom right corresponds to the sequence called site 1 in the result section (AACCACAACCTGCAGCTATTA). Note that lane 3 and lane 4, corresponding to gel shifts with extracts from cells over expressing hc-Rel and hRelaA, respectively, strong shift. Control lane 1 with only the probe (no TF) shows no shift. Lane 2, the other control, represents gel shift with extracts from cells with only the vector. These extract may have some indigenous NFκB from the cell, but the results show very weak shifts compared to the results from lane 3 and 4 coming from the over expression of particular NFκB proteins. The negative control shows that these are results of sequence specific binding.

Back to article page

BMC Bioinformatics

ISSN: 1471-2105

Contact us