Skip to main content

Table 2 The information for the designed CTPP primers for rs12449783 of the SLC6A4 gene

From: Confronting two-pair primer design for enzyme-free SNP genotyping based on a genetic algorithm

  CTPP primer set for rs12449783 Length (bp) GC% T m Tm-diff(°C) Product size (bp)
Pf 1: GATTATTAGTAGTTTCTGCA 20 30 50.96   
Pr 1: TTCTTTATGAATACCAGACG 20 35 51.37 Pf 1/Pr 1: 0.41 Pf 1/Pr 1: 228
Pf 2: AGAAAGTTACAGACTAGCAA 20 30 51.37 Pf 2/Pr 2: 0.41 Pf 2/Pr 2: 105
Pr 2: ATGTTTAATCTCTGAGAAGA 20 35 51.37 Pf 1/Pr 2: 0 Pf 1/Pr 2: 294
  1. The bold font represents a SNP.