Table 2 The information for the designed CTPP primers for rs12449783 of the SLC6A4 gene
From: Confronting two-pair primer design for enzyme-free SNP genotyping based on a genetic algorithm
|  | CTPP primer set for rs12449783 | Length (bp) | GC% | T m | Tm-diff(°C) | Product size (bp) |
|---|---|---|---|---|---|---|
Pf 1: | GATTATTAGTAGTTTCTGCA | 20 | 30 | 50.96 | Â | Â |
Pr 1: | TTCTTTATGAATACCAGACG | 20 | 35 | 51.37 | Pf 1/Pr 1: 0.41 | Pf 1/Pr 1: 228 |
Pf 2: | AGAAAGTTACAGACTAGCAA | 20 | 30 | 51.37 | Pf 2/Pr 2: 0.41 | Pf 2/Pr 2: 105 |
Pr 2: | ATGTTTAATCTCTGAGAAGA | 20 | 35 | 51.37 | Pf 1/Pr 2: 0 | Pf 1/Pr 2: 294 |