Skip to main content

Table 3 LAMP signature candidate regions for S. aureus, as generated by both LAVA and PrimerExplorer. Tm calculated with BioPerl using calculations from SantaLucia(8) with 50 mg/L salt concentration and 50 ng/L oligo concentration

From: LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification) DNA Signatures

Program Primer Sequence Tm (C) 5' Location Length
LAVA F1 GGAATAGTTTGTAAGACACCTGCCA 55.82 149 25
  F2 ACCAACACCAAAAATCGGT 50.22 103 19
  F3 GCTACAATTGCAGGCGTTT 51.66 83 19
  B1 CAAAAACAAAGCGAACTGCCAAT 54.18 209 23
  B2 TGGCATTATTACTTGCCATCA 50.38 260 21
  B3 TTGATGTCGAAAACACTGGAA 50.63 300 21
PrimerExplorer F1 TGTTGGAATAGTTTGTAAGACACCT 53.22 145 25
  F2 TTACCAACACCAAAAATCGG 48.91 101 21
  F3 GCTACAATTGCAGGCGTT 50.80 83 18
  B1 CAAAAACAAAGCGAACTGCCAATA 53.99 209 24
  B2 GCATTATTACTTGCCATCATTG 48.63 258 22
  B3 TGTCGAAAACACTGGAACAT 50.11 296 20