Skip to main content

Table 4 PMS5 on real datasets: predicting transcript factor-binding sites

From: PMS5: an efficient exact algorithm for the (ℓ, d)-motif finding problem

Dataset Best motif found by PMS5 Matched binding sites at:
mus05r AGAGGAAAAAAAAAAGGAGAG seq 1: GGAAAAACAAAGGTAATG
mus07r GCTGCCCACCCTCTGCAACCC seq 4: CCCAACACCTGCTGCCTGAGCC
mus11r AGGGCGGGGGGCGGAGCGGGG seq 2: GCCGCCGGGGTGGGGCTGAG
   seq 3: GGGGGGGGGGGCGGGGC
   seq 4: GTGGGGGCGGGGCCTT
   seq 9: GAACAGGAAGTGAGGCGG
hm03r AAAAGAAAAAAAAATAAACAA seq 1: CGGGTGTTATTCAAGCAAAAAAAATAAATAAATACCTATGCAATAC
   seq 2: GGATGTTACACAAGCAAACAAAATAAATATCTGTGCAATAT
   seq 3: TGGGTGTTATATGAGCAAACAAAATAAATACCTGTGCAACAT
hm08r CAGCGTGCAGTCCCCTTCATC seq 10: TATGGTCATGACGTCTGACAGAGC
hm19r CCCCCTTCCACCACCCACAGA seq 2: CACTTTTAGCTCCTCCCCCCA
hm20r CCTCCTTCCTCCCCCTCCCCC seq 10: TCCTCCCCACCTTCCCCACCCTCCCCACCCTCCCCATAAGCGCCCCTCCCG
   seq 11: GCAAACTCCGCCTCCCCCAA
   seq 14: GTCCCTCCTCCTCCCGCCC
hm22r GGACACGGCAGAGCCTGGGGA seq 4: GAGGCAGACCACGTGAGAGCCTGGCCAGGCCTTCC
hm24r CGCCTGCGCCCCGCCCCGCCC seq 2: CCCCGCCCCGCGCTCCCC
hm26r CCCCCCGCCTCCCGCTCCCAG seq 3: CCCCGCCTCAGGCTCCCGGGG
   seq 7: CTCAGCCTGCCCCTCCCAGGGATTAAG
   seq 8: GCGCCGAGGCGTCCCCGAGGCGC