Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 4 Genes used in the qRT-PCR assays, and the sequence of the PCR primers used in the assays

From: The LO-BaFL method and ALS microarray expression analysis

Gene information Gene role Forward primer (5` to 3`)Reverse primer (3` to 5`)
C12orf35, NM_018169.3 DE gene determined by TM4 analysis CGGGGAAACAAGGTATTTGA TTCACATCACAGTGGGCATT