ChIP-chip score | Target gene(s) | Binding site coordinates | Binding site sequence | Mutation type |
|---|
1.78 | ptrA | 2957002:2957021 | CTATGTTTATATAACCATCA | CTG->ATG x2 |
1.42 | otsB,otsA | 1980128:1980145 | ATATGTGTTT-TA-CCATTG | CTG->ATG x2, 2del |
1.41 | yfaX,yfaW | 2359315:2359334 | ATATGATCGTCTATCCAGTG | CTG->ATG x1 |
1.30 | ydjF,ydjK | 1852887:1852906 | CCCTGTATCTTTTTACATCA | CTG->ATG x1 |
1.03 | ybeR,ybeS | 676025:676044 | AAATGTATTTAGGTACATGC | CTG->ATG x2 |
1.00 | ynaE | 1432307:1432326 | ATATGTTGACTTATACATCG | CTG->ATG x2 |
0.77 | trs5_1,mmuP | 274515:274534 | GGATGTTTAGATGTCCATAC | CTG->ATG x2 |
- In the canonical LexA binding site consensus sequence, ATCTG(TA)10CAGTA, two ‘CTG’ half-site motifs in reverse compliment to each other separated by an intervening sequence of 10 nt are implicated as the most important sequence elements for protein-DNA contact. Among the MotifCatcher-suggested LexA binding site matches for unconventional (type III) sites, 7 of the 19 were defined by substituting one or both ‘CTG’ groups from the canonical consensus sequence with ‘ATG’ (1 of these 7 required an additional 2 nucleotide deletion mutation). The ChIP-chip score column (far left, taken from[35]) reflects the experimentally observed binding strength at each site. The ptr binding site sequence has been experimentally verified to bind LexA when inserted ectopically to a non-LexA-binding region[35]. Given that the other 6 sites in this list share the ‘CTG’ to ‘ATG’ mutation, it is likely that these MotifCatcher-suggested degenerate LexA binding sites also bind LexA in vivo.
