Skip to main content

Advertisement

Table 1 Suggested degenerate LexA binding sites for unconventional LexA targets

From: A Monte Carlo-based framework enhances the discovery and interpretation of regulatory sequence motifs

ChIP-chip score Target gene(s) Binding site coordinates Binding site sequence Mutation type
1.78 ptrA 2957002:2957021 CTATGTTTATATAACCATCA CTG->ATG x2
1.42 otsB,otsA 1980128:1980145 ATATGTGTTT-TA-CCATTG CTG->ATG x2, 2del
1.41 yfaX,yfaW 2359315:2359334 ATATGATCGTCTATCCAGTG CTG->ATG x1
1.30 ydjF,ydjK 1852887:1852906 CCCTGTATCTTTTTACATCA CTG->ATG x1
1.03 ybeR,ybeS 676025:676044 AAATGTATTTAGGTACATGC CTG->ATG x2
1.00 ynaE 1432307:1432326 ATATGTTGACTTATACATCG CTG->ATG x2
0.77 trs5_1,mmuP 274515:274534 GGATGTTTAGATGTCCATAC CTG->ATG x2
  1. In the canonical LexA binding site consensus sequence, ATCTG(TA)10CAGTA, two ‘CTG’ half-site motifs in reverse compliment to each other separated by an intervening sequence of 10 nt are implicated as the most important sequence elements for protein-DNA contact. Among the MotifCatcher-suggested LexA binding site matches for unconventional (type III) sites, 7 of the 19 were defined by substituting one or both ‘CTG’ groups from the canonical consensus sequence with ‘ATG’ (1 of these 7 required an additional 2 nucleotide deletion mutation). The ChIP-chip score column (far left, taken from[35]) reflects the experimentally observed binding strength at each site. The ptr binding site sequence has been experimentally verified to bind LexA when inserted ectopically to a non-LexA-binding region[35]. Given that the other 6 sites in this list share the ‘CTG’ to ‘ATG’ mutation, it is likely that these MotifCatcher-suggested degenerate LexA binding sites also bind LexA in vivo.