SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

BMC Bioinformatics

Table 1 Primer output sheet

No.	Orientation	Primer (5^′-3^′)	Score [%]	nt changes	Tm [°C]	nt	GC%	3^′ΔG	5^′ΔG	RE sites	3^′ GC%	Comments
1	Forward	ACCACTGTTGCATATGCTGATCTGCATCC	69	3	72.16	29	48.28	−8.07	−7.71	1	50	RE sites: NdeI @11
2	Forward	ACCACTGTTGCATATGCTGATCTGCATCCT	70	3	72.75	30	46.67	−7.72	−7.71	1	50	RE sites: NdeI @11
3	Forward	ACCACTGTTGCATATGCTGATCTGCATCCTG	69	3	74.64	31	48.39	−8.2	−7.71	1	75	RE sites: NdeI @11
4	Forward	ACCACTGTTGCATATGCTGATCTGCATCCTGT	64	3	75.06	32	46.88	−7.96	−7.71	1	50	RE sites: NdeI @11
5	Forward	ACCACTGTTGCATATGCTGATCTGCATCCTGTG	66	3	76.82	33	48.48	−6.85	−7.71	1	50	RE sites: NdeI @11
22	Reverse	GCAGATCAGCATATGCAACAGTGGTTAGAGTAG	73	3	70.8	33	45.45	−5.5	−8.27	1	50	RE sites: NdeI @10
23	Reverse	TGCAGATCAGCATATGCAACAGTGGTTAGAGTAG	73	3	72.58	34	44.12	−5.5	−8.65	1	50	RE sites: NdeI @11
24	Reverse	ATGCAGATCAGCATATGCAACAGTGGTTAGAGTAG	73	3	72.64	35	42.86	−5.5	−8.52	1	50	RE sites: NdeI @12
25	Reverse	GCAGATCAGCATATGCAACAGTGGTTAGAGTA	68	3	70.2	32	43.75	−5.48	−8.27	1	25	RE sites: NdeI @10
26	Reverse	TGCAGATCAGCATATGCAACAGTGGTTAGAGTA	68	3	72.04	33	42.42	−5.48	−8.65	1	25	RE sites: NdeI @11

Only the first five Forward and Reverse primers are shown. The program offers a total of 21 Forward and 21 Reverse primers. The output table contains the physical properties of calculated oligonucleotides which are used as a basis for the scoring algorithm. (see Text for details).

ISSN: 1471-2105