Skip to main content

Table 1 Primer output sheet

From: SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

No. Orientation Primer (5-3) Score [%] nt changes Tm [°C] nt GC% 3ΔG 5ΔG Runs Rep. RE sites 3 GC% Comments
1 Forward ACCACTGTTGCATATGCTGATCTGCATCC 69 3 72.16 29 48.28 −8.07 −7.71 0 0 1 50 RE sites: NdeI @11
2 Forward ACCACTGTTGCATATGCTGATCTGCATCCT 70 3 72.75 30 46.67 −7.72 −7.71 0 0 1 50 RE sites: NdeI @11
3 Forward ACCACTGTTGCATATGCTGATCTGCATCCTG 69 3 74.64 31 48.39 −8.2 −7.71 0 0 1 75 RE sites: NdeI @11
4 Forward ACCACTGTTGCATATGCTGATCTGCATCCTGT 64 3 75.06 32 46.88 −7.96 −7.71 0 0 1 50 RE sites: NdeI @11
5 Forward ACCACTGTTGCATATGCTGATCTGCATCCTGTG 66 3 76.82 33 48.48 −6.85 −7.71 0 0 1 50 RE sites: NdeI @11
22 Reverse GCAGATCAGCATATGCAACAGTGGTTAGAGTAG 73 3 70.8 33 45.45 −5.5 −8.27 0 0 1 50 RE sites: NdeI @10
23 Reverse TGCAGATCAGCATATGCAACAGTGGTTAGAGTAG 73 3 72.58 34 44.12 −5.5 −8.65 0 0 1 50 RE sites: NdeI @11
24 Reverse ATGCAGATCAGCATATGCAACAGTGGTTAGAGTAG 73 3 72.64 35 42.86 −5.5 −8.52 0 0 1 50 RE sites: NdeI @12
25 Reverse GCAGATCAGCATATGCAACAGTGGTTAGAGTA 68 3 70.2 32 43.75 −5.48 −8.27 0 0 1 25 RE sites: NdeI @10
26 Reverse TGCAGATCAGCATATGCAACAGTGGTTAGAGTA 68 3 72.04 33 42.42 −5.48 −8.65 0 0 1 25 RE sites: NdeI @11
  1. Only the first five Forward and Reverse primers are shown. The program offers a total of 21 Forward and 21 Reverse primers. The output table contains the physical properties of calculated oligonucleotides which are used as a basis for the scoring algorithm. (see Text for details).