Skip to main content

Table 3 Output format for best ranking primer pair

From: A tool for design of primers for microRNA-specific quantitative RT-qPCR

Name Sequence Score Fprimer_anneal Rprimer_anneal Primer_dimer
ssc -let-7a tgaggtagtaggttgtatagtt 0.32 1.0 1.0 1.0
F_1 gcagtgaggtagtaggttgt 0.64    
R_1 ggtccagtttttttttttttttaactatac 0.5