Figure 1

Primer secondary structure formation. Shown in figure 1A) is the secondary structure stem loop formation for the primer ACATACTGTGAGAAACACAGTATGT. Figure 1B) illustrates an example double-stranded structure formation between the primers ACTAGTACGTAGATCATTCG and GGATGCATACACGGAGAGAT. Note the run of six straight matches between the two sequences. Shown in figure 1C) is the primer-dimer formation between the primers ACTAGTACGTAGATCATTCG and GCATCTACCAGCGATAGCTA. Note the 3' end of the second primer has a run of seven straight matches to the first. The scores for each of these is based on the formula 4 * |G + C| + 2 * |A+T|. For figure 1A) there are 6 A-T base pairs, and 4 G-C base pairs, yielding a score of 28. For figure 1B), there are 6 A-T base pairs, and 3 G-C base pairs, yielding a score of 24. For figure 1C), there are 4 A-T base pairs and 3 G-C base pairs on the 3' end of the second sequence, yielding a score of 20.