Skip to main content

Table 1 Oligos applied in this study. I: Synthesized DNA templates bearing either wild-type binding site (Zif_1) for zif268 or one of its variants (Zif_2 to Zif_6) used for generating DNA binding sites by PCR amplification, where KS-1 and SK-1 are two primers (low case). II: Oligos employed to construct five zif268 variants with QuickChange™ XL site-directed mutagenesis Kit (Stratagene) using pzif268 as a template.

From: Quantitative analysis of EGR proteins binding to DNA: assessing additivity in both the binding site and the protein

I Zif_1 tcgaggtcgacggtatcGCGTGGGCGCtccactagttctagagcggccgccac
  Zif_2 tcgaggtcgacggtatcGCGTGGGCACtccactagttctagagcggccgccac
  Zif_3 tcgaggtcgacggtatcGCGTGGGCCCtccactagttctagagcggccgccac
  Zif_4 tcgaggtcgacggtatcGCGTGGGAGCtccactagttctagagcggccgccac
  Zif_5 tcgaggtcgacggtatcGCGTGGGAACtccactagttctagagcggccgccac
  Zif_6 tcgaggtcgacggtatcGCGTGGGACCtccactagttctagagcggccgccac
  KS-1 tcgaggtcgacggtatc
  SK*-1 gtggcggccgctctagaact (SK-1 was fluorescent labeled with either FAM, HEX, TAMRA, ROX, or CY5)
II 18Q_plus 5' CGCCGCTTTTCTcagTCGGATGAGCTTACCCGCC
  18Q_minus 5' GGCGGGTAAGCTCATCCGActgAGAAAAGCGGCG
  18D_plus 5' CGCCGCTTTTCTgatTCGGATGAGCTTACCCGCC
  18D_minus 5' GGCGGGTAAGCTCATCCGAatcAGAAAAGCGGCG
  21N_plus 5' CGCCGCTTTTCTCGCTCGGATaacCTTACCCGCC
  21N_minus 5' GGCGGGTAAGgttATCCGAGCGAGAAAAGCGGCG
  18Q_21N_plus 5' CGCCGCTTTTCTcagTCGGATaacCTTACCCGCC
  18Q_21N_minus 5' GGCGGGTAAGgttATCCGActgAGAAAAGCGGCG
  18D_21N_plus 5' CGCCGCTTTTCTgatTCGGATaacCTTACCCGCC
  18D_21N_minus 5' GGCGGGTAAGgttATCCGAatcAGAAAAGCGGCG