Skip to main content

Table 5 Representation of the spotted probes exhibiting negative correlation coefficients with Affymetrix probes.

From: Construction and validation of the APOCHIP, a spotted oligo-microarray for the study of beta-cell apoptosis

Long oligonucleotide sequence 5'-3' GenBank accession no. Probe Set ID RAE230A Correlation coeficient
CACAGAAGATGGAGAAAATCTAAAG-TGAAAGTGCGCGTGACACACATGCA cXM_213699
*NM_001011901
c1388898_at -0.37107
CAGACCTTCATCGCTCTGTGTGCTACCGA-CTTCAAGTTTGCCATGTACCCGCCATCGA cD16308 c1370810_at -0.24892
GGACATCTGAGTTGAGACCCAGTTGTTAC-TAACCTTATTGTGAATTGCCTGATCTACA a,bM11794 a,b1371237_A_AT -0.13854
ATTCTCTGGTCTAATGTCTGGCTGGGGT-TCTCCGTCTGCTTCCTGTATCTATATTCT bM15562 b1370883_AT -0.43223
ACTTACAAGGACCAAATACCAAACTAGAAG-AAAAGATAGACATGGTGCCTATTGACTTTC cM63101 c1387835_AT -0.93746
CTAAAATTGGGCTTGCGGTTTTCATTTCTG-ATGTCTCTGGATTGGCACCCTTATGGTTTA a,b,dNM_019356 b,d1367713_at -0.88595
GTCTGTAAAATAACCATCAGTTCCTTCAC-CCACCCTCTTCCCCTTAACACTCAGC bXM_340904
*NM_012809
b1387897_at -0.6239
TGTAAATTACACCACGGACTTCATCTACC-AGCTCTACTCAGAGGAAGGGAAAGGAG a,bL25387 b1372182_at -0.37801
GTCTTGACAATGTTCACAAACAGAGAGT-GGCTGAAGTGCTAAATGACCCTGAGAA a,b,dXM_216792
*XM_343114
a,b1370886_a_at -0.82769
  1. a. Low signal intensity (signal below mean of all arrays); b. Affymetrix and long oligonucleotide probes mapped to the APOCHIP target mRNA; c. Affymetrix and long oligonucleotide probes mapped partly or not at all to the APOCHIP target mRNA; d. Probes exhibiting variation close to the lower limits shown in Figure 4. *. New annotation obtained by BLAST.