Skip to main content

Table 3 Sequences of real-time quantitative RT-PCR primers and probes of high-, medium- and low-abundance gene transcripts in rats

From: Biologically relevant effects of mRNA amplification on gene expression profiles

Gene Primer Sequence (5'→3') Position
Cyclophilin A (M19533) (high) F GGGAGAAAGGATTTGGCTATAAGG 167–190
  Probe TGAAGTCACCACCCTGGCACATGAAT 219–244
  R GCCACCAGTGCCATTATGG 249–267
Ribosomal Protein S9 (NM_031108) (medium) F CTCGACCAGGAGCTAAAGTTGATT 99–122
  Probe ACACCTCACGTTTGTTCCGGAGTCCATACT 127–156
  R TCTTCGCCAGGGTAAATTTGA 163–183
Collagen VI alpha 3 (XM_346073) (low) F CAGGAGGACCGAGAGCTCAT 7630–7649
  Probe ATGCCTTGCAGATCAATAACACAGCAGTAGG 7652–7682
  R CCCTCCTTGCAGGCAGAAC 7693–7711
  1. The probes were labelled at the 5' and 3' positions with 6-carboxyfluorescein reporter and 6-carboxytetramethylrhodamine quencher, respectively. The position of the primers and probes were annotated according to the sequences derived from GenBank (accession numbers given in parenthesis). F, forward; R, reverse.