Skip to main content

Table 1

From: Lower bounds on multiple sequence alignment using exact 3-way alignment

Sequence # Sequence
1 ATGGGTTGCGTCAGGAGTAAAGAAGCCAAGGGCCCGGCACTGAAGTACCA
2 ATGGGCTGTATTAAAAGTAAGGAAGACAAAGGACCAGCAATCAAGTACAG
3 ATGGGCTGCATTAAAAGTAAACAAAAGTCCAGCCATAAAATACAC
4 ATGGGCTGCATTAAAAGTAAAGAAAACAAAAGTCCAGCCATTAAATACAG
5 AGGGGTGCATTAAAAGCAAAGAAGATAAAGGTCCAGCCATGAAATACAG
6 ATGCTGTATAAAAAGTAAGGAAGACAAAGGACCATCCATCAAGTACAG
7 ATGAGTTGCGTCAGGAGTAGAGAGCTAAGGGCCCGGCACTGAAGTACCA
8 ATGGGTTGCATTAGAAGTAAAGAAAACAGAAGTCCAGCCATCAAATACAC
9 ATGAGCTGTATTAAGTAAGGAAGACAAAGGACCAGCAATGAAGTACAG
10 ATGAGCTGCATTAAAAGTAAAGAAAACAAAAGTCCAGCCATTAAATACAG
11 ATGAGGTGCATTAATAGCAAAGAAGATACAGGTCCAGCCATGATACAG
12 AGAGCTGTATAAAGAGTAAGGAGACAAAGGACATCCATCAAGTACAA
13 ATGGCTTGCGTCAGGAGTAAAGAAGCCAAGGGCCCAGCACTGAAGTACCA
14 ATGGGCTGCATTAAAGTAAAGACAAAAGTCCAGCCATGAAATACAC
15 ATGGGCTGTATTAAGAGTAAGAAGACAAAGGACCAGCAATCAAGTACAG
16 AGTGGCTGCATTAAAAGTAATGAAAACAAAAGTCCAGCCATTAAATACAT
17 ATGGTGTGCATTAGAAGTAAAGAAGACAGAAGTCCAGCCATCATATAGAC
18 AGACGTGTATACAGAGTAAGGAGACAAAGGACATCCATCAAGTACAG
\