Skip to main content

Table 1 BLAST results for the highest up and down-regulated genes by fold change

From: Analysis of probe level patterns in Affymetrix microarray data

    Hsbp1   Highest Up-regulated Gene    
    Log 2 Array Mean centered   Perf. Seq. Probe Sequence
  Probe Probe Probe Intensity by Array   w. target Overlap Homology
Probe sequence Name Position A B C D Affin. gene   Perf. Part.
GGCAACTCAGCAGCGGTGTCTCAGA 1 309–333 -0.867 -0.771 -0.952 -0.860 0.953 0 5 1 33
TCAGAGATCCGACAGACGGCCGATC 2 329–353 -1.560 -1.322 -0.890 -0.646 0.123 1 0 1 2
GAGGAGCTCACAGTTAAGACCAAGG 3 392–416 -1.583 -1.287 -0.933 -0.991 -0.781 0 0 1 28
GATGAACATGGCTACATCTCTCGGT 4 458–482 0.862 0.429 4.728 4.665 0.198 1 0 3 28
AAGCAGTCACACAATCAGCGGAGAT 5 585–609 -1.310 -1.430 -1.198 -0.879 -0.500 1 6 3 10
GGAGATCACCATTCCGGTCACTTTC 6 604–628 0.105 0.119 3.522 3.191 1.606 1 3 3 6
TTCGAGGCCCGTGCCCAAATTGGAG 7 626–650 2.880 2.293 3.521 2.828 2.127 1 5 3 5
TGGAGGCCCAGAGTCGGAACAGTCT 8 646–670 -0.974 -0.827 -0.993 -0.841 0.412 1 4 3 16
GTCTGGAGCCAAGTAGAAGCCTTCA 9 667–691 -0.215 -0.384 3.274 3.027 -0.843 1 12 3 33
TAGAAGCCTTCAGCTTGCTACCCAT 10 680–704 0.970 0.812 0.711 0.546 1.685 1 0 3 21
TCCCTCTCTGTCAATCTGATATGCT 11 727–745 0.303 0.069 2.940 2.345 1.162 0 NA 0 19
    Id2   Highest Down-regulated Gene    
TGGACGACCCGATGAGTCTGCTCTA 1 144–168 1.507 0.623 0.342 0.258 1.1012 1 1 4 3
ACAACATGAACGACTGCTACTCCAA 2 168–192 1.861 1.423 0.630 0.399 -0.082 1 10 4 9
GCTACTCCAAGCTCAAGGAACTGGT 3 183–207 0.437 0.156 -0.616 -0.511 -0.124 1 0 4 45
ATCCTGCAGCACGTCATCGATTATA 4 248–272 2.003 1.848 0.710 0.615 1.358 1 5 4 17
TTATATCTTGGACCTGCAGATCGCC 5 268–292 0.688 0.442 -0.215 -0.221 0.6038 1 0 4 37
TGAACACGGACATCAGCATCCTGTC 6 375–399 0.806 0.775 -0.041 -0.034 0.3126 1 8 4 32
ATCCTGTCCTTGCAGGCGTCTGAAT 7 392–416 0.741 0.822 0.310 0.826 2.1972 1 4 3 15
GAATTCCCTTCTGAGCTTATGTCGA 8 413–437 2.422 2.189 1.162 0.656 1.4553 1 0 3 41
TTCTCTTTTTCTTTTGCACAACAAG 9 518–542 0.375 -0.217 -0.369 -0.691 1.1409 1 0 3 97
TGTTATCAACCATTTCACCAGGAGA 10 587–608 0.434 0.713 -0.350 -0.557 0.0674 1 0 3 40
GGCCTGGACTGTGATAACCGTTATT 11 683–707 2.214 1.663 1.130 0.615 -0.061 1 NA 3 19
  1. The BLAST search was restricted to organism Rattus norvegicus, however there is some duplication due to presence of multiple entries in some databases used in BLAST. Note that not all probes for Hsbp1 match perfectly with the target gene.