Skip to main content

Table 2 The primer sequences for the real-time PCR experiments. The gene specific primer for tobacco (Nicotiana tabacum) NtWBC1 gene and Arabidopsis AtWBC19 gene were designed as follows.

From: Statistical tools for transgene copy number estimation based on real-time PCR

Gene Name Forward Primer Reverse Primer
NtWBC1 ATCTCACGTAGCCGGAGCA TTTGTTCTGGTGGACGGGAT
AtWBC19 AAGAAACGCGGCGAACAC GCCGTCTCTCTCCTCCAGAA
AtWBC19 TTAGCCAAACGGTACATGAAAAAC CCAGTCACCATTACCGTAGCAA