Figure 10From: An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutionsDot Plot with a Suboptimal Structure for Artificial Example I. The dot plot for a sample suboptimal solution, and the optimal solution, corresponding to the rearranging mutation A15G-U20G (the example is for the sequence CCUUAACCAGCAAAAACUGCUGG).Back to article page