Figure 11From: An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutionsMutation Group List Screen in Artificial Example II. Mutation group list screen as a result of our procedure, for the case of 3-point mutations (the example is for the sequence CCGGAAGAGGGGGACAACCCGGGGAAACUCGGGCUAAUCCCCCAUGUGGACCCGCCCCUUGGGGUGUGUCCAAAGGGCUUUGCCCGCUUCCGG).Back to article page