Figure 6From: An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutionsSecondary Structure Drawings for the Wild-type and Mutant. Secondary structure drawings for the wild-type and the mutant as a consequence of applying the rearranging point mutation found by our method, for the example in Figure 1 (the example is for the sequence UGCCUGCCUCUUGGGAGGGGC).Back to article page