Skip to main content

Table 3 Strong promoter candidates identified in T. maritima MSB8*.

From: Triad pattern algorithm for predicting strong promoter candidates in bacterial genomes

Downstream located gene(s)** Strong promoter candidate sequence*** Total score****
TM_0013
conserved hypothetical protein
Operon: 2 genes
ACAATTTTTATCTGATATTTTTTTCACAttcaccatagtcgatTATAAC
<--- 97 bp --->aatctggaggtgacaatATG
0,8475
TM_0110
transcriptional regulator, XylR-related
Operon: 6 genes
ACCTTGATTTTAAATTATTTCCTGCATataattaatgtgaaCATAAT
<--- 10 bp --->aaaaggaggaatcgaagTTG
0,805
TM_0280
hypothetical protein
Operon: 6 genes
GCAATATTTGTCCAGAAATATACTTGATTtaacaaaaatggacaatgTAGAAT
<--- 37 bp --->aaggaggaatatcgtttATG
0,88
TM_0339
hypothetical protein
Operon: 3 genes
AGAAAAATTTTTTTGGAGACTTGACAaaatatttggtaatattcTAAAAT
<--- 5 bp --->gcaggaggtgacaaaatATG
0,8975
TM_0373
dnaK protein
Operon: 2 genes
TTTTACAAATTCTCATACGACCCCTTGACAtcccattctgtgcctcacTATAAT
<--- 21 bp --->tctaaggaggtgacacaATG
0,94
TM_0657
rubrerythrin
Operon: 3 genes
TAATGTAACTATTCAAAATCATTACAgtttataattatgtggTAAAAT
<--- 22 bp --->atagggaggtgcagggtATG
0,8125
TM_0682
hypothetical protein
Operon: 3 genes
GAATACTCTGTCAGAAAGATTCGTGATCAtcttttcacctcgtgtagTATAAT
<--- 7 bp --->gagtattcttctacacaATG
0,915
TM_1016
hypothetical protein
TAAAAATTTCATGAAAAATTTCTTGAATtctgtgaccaaaagggTTTAAT
<--- 5 bp --->gccggaggtgatgtgagATG
0,9175
TM_1167
hypothetical protein
GAAAAGTTACAGAAAAAGTACCCTTGTTAtctgaaggtgaaaaatggTAAAAT
<--- 61 bp --->tacagggagggcgggagATG
0,865
TM_t27
tRNA-Asn
TCATTCATTTTACCATCGAGTCCACTTGAAAttcaggaaggtatgtagTACAAT
<--- 0 bp --->tatccgtggaggttcc
0,8675
TM_1205
conserved hypothetical protein
Operon: 13 genes
GTTTTTTATCTCTACTAATTAGGTTGACAttattgattcagaagagTAAAAT
<--- 40 bp --->ccgaggaggtgtgatgaGTG
0,88
TM_1318
Operon: 2 genes
AGAAACAATTTTGGAATTTGATCCATGGACAttattacctttaatgGATAAT
<--- 0 bp --->tttaacggaggATG
0,8325
TM_t34
tRNA-Leu
AGAAAAATTTCCGATGAGGGTACTTGAAAagggtgaaaacctgtgcTATTAT
<--- 0 bp --->atatgtcggagttgcc
0,855
TM_1429
glycerol uptake facilitator protein
Operon: 3 genes
GCATTGTGATTTTTGTAACTATATTGACAtaaaacaaaaggtttgtTATAAT
<--- 107 bp --->caaggaggattgggaaaATG
0,9175
TM_t39
tRNA-Ala
Operon: 3 genes
AAAAATAAAAAGTCCTTCTGGGGATTGACCatatttcgtactcatgcTATAAT
<--- 50 bp --->taatataaagacgaggtggg
0,8725
TM_1667
xylose isomerase
Operon: 2 genes
AAGTATATCCTAAAAAAATATTTGAAAtgataccccaagattttaTATAAT
<--- 16 bp --->tttagggaggtgtttacATG
0,905
TM_1780
argininosuccinate synthase
Operon: 6 genes
GAAAATAACAGTGAAAAAACACTTCATAtaaatcatttcaaataatccTATAAT
<--- 15 bp --->aaagaggagggttcatcATG
0,875
TM_0150 (complem.)
ribosomal protein L32
Operon: 5 genes
AAAAATGTAAAAGAAGAGAAACTTGAATctttgaaaaacatcaTATACT
<--- 210 bp --->acgaggaggtataaaagATG
0,855
TM_0477 (complem.)
outer membrane protein alpha
ACAAAAAAACTTTAGAAAACTCTTGAATttcctttggacgggatggTATAAT
<--- 28 bp --->gaagggaggtttgtcccATG
0,9425
TM_0625 (complem.)
hypothetical protein
ATATTCGTTCTGAATGAAGGTTTTACATttcatccaaattattttggtTATAGT
<--- 152 bp --->attggaggcaaatagaaATG
0,805
TM_0656 (complem.)
conserved hypothetical protein
Operon: 2 genes
AACTTAAGTAACACAAAATTAACCTTGACAacgaaaggggggtgggTATAAT
<--- 42 bp --->aaggggttgggaactttGTG
0,8925
TM_0755 (complem.)
conserved hypothetical protein
Operon: 2 genes
AGAAATTCTTTGAAAACTATCTAGAATtcaaacgtcgcttttccagTATACT
<--- 101 bp --->aatggaggtgtctctgtATG
0,85
TM_0971 (complem.)
hypothetical protein
AAATATAAATCTGAATTTACTAAATTCACAtttagcaaatcatcattTATAAT
<--- 10 bp --->aggaatctcaagggggaATG
0,895
TM_1015 (complem.)
glutamate dehydrogenase
ATAATTTTTGCAATTTTATCTCTATACAtctcacatcacctccggctaTATATT
<--- 104 bp --->ttcgaggggggaaatgtATG
0,855
TM_1067 (complem.)
oligopeptide ABC transporter, periplasmic
GGATTATTTTATACTGAAAGCCCTTGACCttgttgtatgtttgttgaTATTAT
<--- 45 bp --->ataacgcagggggtggtATG
0,92
TM_1271 (complem.)
type IV pilin-related protein
GGGTGATATTTCAACATTAAAATCTTGACAttctaccatgtcaaggtgTATAAT
<--- 35 bp --->cccgggaggtggattttATG
0,9525
TM_1286 (complem.)
5-methyltetrahydropteroyltriglutamate...
GTTTATGCAAATTTTCCTTCTGTTAACCAtgttacacacaacatgtggTATCAT
<--- 19 bp --->aatggaggtgaaaagggTTG
0,8625
TM_t31 (complem.)
tRNA-Leu
AAGTTTTGATTTTTGTAAGGTTGAAAtaatctttctgacgatgtggTATAAT
<--- 0 bp --->aaaaaaaggagcc
0,86
TM_1412 (complem.)
hypothetical protein
ATATGGAAGTTCAAAAAACATCTTGCTTtcagagtgtgtttgtggTATAAA
<--- 24 bp --->aataattccttagaggtATG
0,865
TM_1419 (complem.)
myo-inositol-1-phosphate synthase-...
Operon: 3 genes
AGAAAACTATTGGTAAAGCACTTGAAAtatatgactgtaaaaacgtgaTATAAT
<--- 61 bp --->ctaaggaggtgaaacatATG
0,87
TM_1439 (complem.)
hypothetical protein
Operon: 3 genes
TAGTATTCTACCCTAAACTCTTTCAttctggattcgataatTGTAAT
<--- 222 bp --->tgagagtgaaaaaggccATG
0,835
TM_t45 (complem.)
tRNA-Ser
AAAAGAAGGAAGAAAAATGAAAACTTGAACaaggaaacgattgagtgTATAAT
<--- 1 bp --->tttttctggtgtggagagga
0,865
TM_1786 (complem.)
hypothetical protein
GTATTATTCATTCTAAAAACTTGAAActgaccaaataaagtatTAGAAT
<--- 44 bp --->cacaagggggtgttttcATG
0,855
TM_1850 (complem.)
hypothetical protein
AAACGATTCTTCTAAAATGTGTTCTTGATTtgtatcactgttatgtTATAAA
<--- 43 bp --->aaaaaggaggtgaaactATG
0,855
TM_t11
tRNA-Thr
Operon: 2 genes
GAAAAGGGTTATCAGGAAATATCTTGAATagaaaaggttcgtgtgtTAAAAT
<--- 0 bp --->aaccacagaggcgagca
0,8825
TM_1272
glutamyl tRNA-Gln amidotransferase...
Operon: 3 genes
TTTCACATTTTGCATTATACACCTTGACAtggtagaatgtcaagatTTTAAT
<--- 99 bp --->ataatccacgagaggagGTG
0,8975
TM_0032 (complem.)
transcriptional regulator, XylR-related
Operon: 1 genes
AATATTAGAATTTGAACTATAATTCGAAAtaattcctgttattcactCATAAT
<--- 79 bp --->agcaggaggaatatggaGTG
0,86
TM_1490 (complem.)
ribosomal protein L14
Operon: 22 genes
GGTGAAAATATGCCCAGGAAACGTTTGACTggaatagttgtgagcgaTAAAAT
<--- 259 bp --->aagggaggggttgaatcATG
0,845
  1. * The genome annotation of T. maritima AE000512 used for analysis was dated 28th December 2005.
  2. ** The gene order for the first 34 candidate sequences is shown on both strands as described in the annotated genome [49]. The complementary strand is noted as (complem).
  3. *** The spacer between -35 and -10 sites and the region located downstream of the -10 site are shown in lowercase; the initiation codons of the ORFs are shown in capital letters at the end of the corresponding sequences.
  4. **** The first 34 candidate sequences were detected with the score parameters sUP = 13, s35 = 6, s10 = 5; TMt11, TM1272, TM0032 and TM1490 were detected with sUP = 12, s35 = 6, s10 = 5 and used for analysis in a cell-free system (see Fig. 3).