Skip to main content

Table 1 Primer sets used for amplification and sequencing of Coxsackievirus B2

From: Phylodynamic reconstruction of the spatiotemporal transmission and demographic history of coxsackievirus B2

Gene Primera Sequence Positionb Reference
VP3 2400F GCTTTGTGTCTGCMTGYAATGA 2372-2393 CDC-TWc
VP1 222R CICCIGGIGGIAYRWACAT 2909-2891 [20]
VP1 292F MIGCIGYIGARACNGG 2550-2565 [20]
2A 011R GCICCIGAYTGITGICCRAA 3327-3308 [20]
3Dpol PY-03F GTYACMTATGTGAARGATG 6383-6398 This study
3Dpol PY-04R CTTCATTGGCATTACTGGATG 7104-7085 This study
  1. aF: Forward primer, R: reverse primer
  2. bNumbering system used for the Coxsackievirus B2 strain (Accession No. AF085363)
  3. cPrimer designed by the Centers for Disease Control, Taiwan