Skip to main content

Table 1 Primer pairs for the candidate genes

From: Are orphan genes protein-coding, prediction artifacts, or non-coding RNAs?

Gene identifier Primer identifier Primer sequence
Contig1-snapTAU.32 C1.32F1 TCTGTCCAGAGGAACGAATGGGATC
  C1.32R1 TGCACACTAACAAGTCTTCCCTCAG
  C1.32F2 CAGGAAAGATCGTCAAACAGGACCA
  C1.32R2 TGATTTCTCTTCAGGAGACACTCAG
Contig115-snapTAU.38 C115.38F1 GTCAGAGTGGAAATCAGTGCAACTG
  C115.38R1 TCACTTCCGTGTGTACGATTGACTT
  C115.38F2 ATGCCGAGCACAGAACAAATGCTGC
  C115.38R2 ACCGAGATTGCGGAAAACAGCGCAA
Contig159-snapTAU.23 C159.23F1 TTCATCGCTGACGATCACAGGCACA
  C159.23R1 AGATCATCATGCAGCCCTCCTTTGC
  C159.23F2 ATGCTCAAACTCCTCGTCTTCACCA
  C159.23R2 ACGATTTGACTGCGGGCTCTGCCTT
Contig162-snapTAU.8 C162.8F1 ATCAATGGCAATAAATCCGCTTACG
  C162.8R1 ATAAAGCCGTGAAGGTAATTCTCAT
  C162.8F2 AATAAATCCGCTTACGAACCAATCG
  C162.8R2 GGTAATTCTCATATTTGATGATTCC
Contig163-snapTAU.25 C163.25F1 GCAATCCCTCTACTGGCAGAATCTC
  C163.25R1 ATTGCATGGAGAGTACGTATCCGAC
  C163.25F2 AACTATGAAGGCGGTGATTCATTGG
  C163.25R2 GTTCGTTGAAAATCCACACTTTTCG
Contig27-snapTAU.5 C27.5F1 ACAAGAAGGCATACATGATGTACCC
  C27.5R1 AGTAGTCGAGGTGATGCTGTCAGGA
  C27.5F2 AACTGCATCTCAGACGCATCGGACA
  C27.5R2 TTTGACCTTGAACGCTTTCCTCCCG
Contig51-snapTAU.126 C51.126F1 ATGCTTGCGTGCATTGGGATCATCG
  C51.126R1 TAGCTCATTGAGATCAATGTCTTCG
  C51.126F2 TGACCTTCCTCGGCGGATGTTCCA
  C51.126R2 AGTTCACTTAGGCTCTCAAATGAGG
Contig57-snapTAU.76 C57.76F1 AGGAGATGATCGATAAACACAAAGCC
  C57.76R1 TCTTCTTCTGCAGCTGATTTGCCAC
  C57.76F2 TCGACAAGTGCTTCAAAGCCGAGCT
  C57.76R2 AAGATCCTCAAACTTCTCGCTGTG
Contig62-snapTAU.17 C62.76F1 TGCAAGTTGCACATCTCAACCACCT
  C62.76R1 ACACTTGGTTTCTTGAATGAGCTAAC
  C62.76F2 TGGGGATATCAAGTGCAAAGGCACTG
  C62.76R2 TTGGCTGGTTGGCTCTCGAATACTG
Contig67-snapTAU.30 C67.30F1 ATTCGACGTCTACTCTCACGCAACA
  C67.30R1 ATACGAAGTACAACATCACCTTGAG
  C67.30F2 TTCCGGCACACTTCTCATCATTCTC
  C67.30R2 AAATGAACGAGTACAACAGTAAACC
Contig68-snapTAU.138 C68.138F1 ACTGATTGCTGCTCATACAGATCGA
  C68.138R1 ACTGAGGAGCATCGTAAGCTGACTC
  C68.138F2 TCTTATTGGCTATACTGATTGCTGC
  C68.138R2 ATCCACTTTCCTGTCGAATTGACGC