Table 3 Six examples of REHUNT provided for user operations

1

Universal judgement of whether a variation of a sequence can be recognized by restriction enzymes

The input variations may include two variations, three variations, or four variations.

2

Search for specific restriction enzymes

For example, the sequence “ACGG[A/C]TTTTTT” can be recognized by restriction enzyme TspGWI (ACGGA) for variation A. The sequence “ACGG[A/C]TTTTTTACGGATTT” can be recognized by restriction enzyme TspGWI (ACGGA) for variation A, but it will be excluded because of the repeat of the sequence “ACGGA”. REHUNT identifies specific and available restriction enzymes, thus, the reappearing restriction enzyme TspGWI (ACGGA) will be excluded.

3

Identify restriction enzymes for a sequence and complementary sequence with multi-variation (Please use Example 3_1, Example 3_2, and Example 3_3)

The sequence “TTAGCATCAGCATTTGCTGC[multi-variation]

ATCGCTAACGGTGGATCTAC” with multi-variation that can be recognized by restriction enzymes. Its complementary sequence can also be recognized by restriction enzymes. These restriction enzymes are easy identified by REHUNT.

Example 3_1, Example 3_2, and Example 3_3 are provided for two variations, three variations, and four variations, respectively.

4

Only restriction enzymes with eliminated IUPAC format are evaluated

The sequence “AATTTCTGG[A/G]CCCTAACGGT” can only be recognized by restriction enzyme BspGI (CTGGAC) with eliminated IUPAC format for variation A. The function setIUPACenzyme(false) in “JudgeRFLP” class is used.

5

All restriction enzymes including IUPAC format are evaluated

The sequence “AATTTCTGG[A/G]CCCTAACGGT” can be recognized by many restriction enzymes including IUPAC format for variation A. The function setIUPACenzyme(true) in “JudgeRFLP” class is used.

6

High throughput analysis

The multiple sequences can be analyzed by “JudgeRFLPBatchThread” class. The function is useful for high throughput analysis.