Fig. 5
From: SSS-test: a novel test for detecting positive selection on RNA secondary structure
Minimum Free Energy (MFE) structures of MIATsub92 local structures of Human and Pan. The duplication of a TTTGAACTTGGCTAACACAGG sequence in the human lineage might have driven the evolution of the structure towards a more stable structure. Prevailing red regions exhibit well-defined structures with probabilities close to 1 for paired and unpaired bases. Duplicated regions are labeled with horizontal and vertical lines, and G/A nucleotide substitution is marked with an arrow. Bonobo has the same sequence as the chimpanzee