Skip to main content

Table 3 Primer sequences for qPCR

From: Prediction of regulatory targets of alternative isoforms of the epidermal growth factor receptor in a glioblastoma cell line

Traget mRNA Label Sequence 5→3 Localization Corresponding mRNA
ALDH4A1 Sense AGTGGGACTTTGGCTGATCC 128-147 NM_170726.2
  Antisense GTGAAGGCTAAGACGGGCTC 398-379  
CKAP2L Dense ACATCAGTGGAAGAGCTGGC 1940-1959 NM_152515.4
  Antisense TTCTGCCTTGGCTATTCGGG 2044-2025  
CLCA2 Sense CCATTGCCCTGGGTTCATCT 1690-1709 NM_006536.6
  Antisense GGCCTGCCACGTAACTAGAA 1961-1942  
EGFR all Sense TCAGCCTCCAGAGGATGTTC 392-411 NM_005228.3
  Antisense GTGTTGAGGGCAATGAGGAC 511-530  
EGFR v1 Sense CCCAGTACCTGCTCAACTGG 2689-2709 NM_005228.4
  Antisense TAGGCACTTTGCCTCCTTCTG 2889-2869  
EGFR v4 Sense GCCATCCAAACTGCACCTAC 2105-2126 NM_201284.1
  Antisense GGACACGCTGCCATCATTAC 2211-2192  
GALNS Sense CAGCTGTTGCTGGTGCTCAG 123-142 NM_000512.4
  Antisense AGTTTGGGAAAAGCAGCCCT 303-284  
GAPDH Sense CACCCACTCCTCCACCTTTG 943-962 NM_002046.7
  Antisense CCACCACCCTGTTGCTGTAG 1052-1033  
HPRT Sense TTGCTGACCTGCTGGATTAC 391-410 NM_000194.2
  Antisense CTTGCGACCTTGACCATCTT 652-633  
MMP2 Sense CCCTCGCAAGCCCAAGTGGG 650-669 NM_004530.5
  Antisense CCATGCTCCCAGCGGCCAAA 848-828  
ROCK1 Sense GGTGCTGGTAAGAGGGCATT 905-924 NM_005406.2
  Antisense CGCAGCAGGTTGTCCATTTT 997-978  
TPR Sense GCTGAGGGTGGACTCGATTT 115-134 NM_003292.2
  Antisense AGACTTGGGCAGCTTGTTCA 357-338