Skip to main content

Table 1 The sequences of the primers specific for target genes

From: Developing the novel bioinformatics algorithms to systematically investigate the connections among survival time, key genes and proteins for Glioblastoma multiforme

Target gene The sequences of the primers specific
HES1-F 5’GGCGGCTAAGGTGTTTGGAGG3’
HES1-R 5’GGGCCGCTGGAAGGTGACAC3’
HK2-F 5’AGGGGACTTTGATATCGACATTG3’
HK2-R 5’GCCCCCCACTCCATATTGATAC3’