Skip to main content

Table 1 Primer pairs used in this study and the covered variable regions

From: Joining Illumina paired-end reads for classifying phylogenetic marker sequences

Primer pair Forward/ reverse sequence Covered variable region
27F/534R AGAGTTTGATCCTGGCTCAG/ ATTACCGCGGCTGCTGG V1-V3
357F/926R CCTACGGGAGGCAGCAG/ CCGTCAATTCMTTTRAGT V3-V5
341F/785R CCTACGGGNGGCWGCAG/ GACTACHVGGGTATCTAATCC V3-V4
341F/1062R CCTACGGGNGGCWGCAG/ CRRCACGAGCTGACGAC V3-V6
8F/785R AGRGTTYGATYMTGGCTCAG/ TACHVGGGTATCTAAKCC V1-V4
27F/1492R AGRGTTYGATYMTGGCTCAG/ RGYTACCTTGTTACGACTT V1-V9
  1. Note that he primer coordinates are adapted from the original references, which might apply different coordinate systems