Skip to main content

Table 1 List of primers used in PCR

From: Modeling of shotgun sequencing of DNA plasmids using experimental and theoretical approaches

VectorSize (nt)ForwardReverse
TOPO*100AATGCAGCTGGCACGACAGAGGCACCCCAGGCTTTACA
TOPO400CAGCTGTGCTCGACGTTGTGGATTCATCGACTGTGGCCG
TOPO800GCAGCAGATTACGCGCAGAAATGGGCTGACCGCTTCCT
QE**100ACCGCCAAGCTGAAGGTGACAAGGCCTACGTGAAGCACC
QE400AGGTCGTTCGCTCCAAGCTTCTACGGGGTCTGACGCTCA
QE800GCAGCAGATTACGCGCAGATAGTGTATGCGGCGACCGA
LEXSY***100TGTCTCATGAGCGGATACAGTCTCATGAGCGGATACAT
LEXSY400GTCTCATGAGCGGATACATAGTTCGTCTTTCATCCAGTT
LEXSY800CTGGCGCCTCTCTAGACACACCGACAAGCAGAAGAACGGC
  1. *-pCR™4-TOPO®; **- pQE-30-UA-mCHERRY-GFP; ***- pLEXSY-Ig-1