Table 1 Primers and probes used in this study
From: rprimer: an R/bioconductor package for design of degenerate oligos for sequence variable viruses
Assay name | Application | Type | Sequence (5′-3′) | Sense | Intended binding region in the norovirus GI reference sequence (NC_001959.2) | References |
|---|---|---|---|---|---|---|
A | Detection | Forward primer | GCCATGTTCCGCTGGATG | Plus | 5282–5299 | This study |
A | Detection | Reverse primer | CGTCCTTAGACGCCATCATCATTTAC | Minus | 5354–5379 | This study |
A | Detection | Probe | [FAM]-CGRTCTCCTGTCCACA-[MGB-EQ] | Minus | 5319–5334 | This study |
Reference | Detection | Forward primer | CGCTGGATGCGNTTCCAT | Plus | 5291–5308 | |
Reference | Detection | Reverse primer | CCTTAGACGCCATCATCATTTAC | Minus | 5354–5376 | |
Reference | Detection | Probe | [FAM]-TGGACAGGAGATCGC-[MGB-EQ] | Plus | 5321–5335 | |
B | Typing, amplification | Forward primer | CTTCACAGGTGAACAGCATAAAYCAYTGG | Plus | 4758–4786 | This study |
B | Typing, RT and amplification | Reverse primer | CATGTTGCCAACCCAACCRTTRTACA | Minus | 5653–5678 | This study |
B | Typing, sequencing | Forward primer | CTTCACAGGTGAACAGC | Plus | 4758–4774 | This study |
B | Typing, Sequencing | Reverse primer | CATGTTGCCAACCCAACC | Minus | 5661–5678 | This study |