Table 2 The command options of MethyQA

[-i <file>]

FASTQ input file

[-t <file>]

Target input file (i.e., a list of target regions specified for analysis). “F”, if do not perform target analysis

[-d <dir>]

Path to MethyQA directory (e.g., /home/user/downloads/MethyQA/)

[-c <string>]

Chromosome number (e.g., chr1, chr2, chr17, chrX, chrY, etc.)

[-p <string>]

Prefix (i.e., the prefix written to the output file names)

[-R <dir>]

Reference directory (i.e., the directory with the genome reference files)

[-r <file>]

Reference name (i.e., the file name of the reference that the user will use)

[-f <string>]

FASTQ format (i.e., “sanger” or “illumina”)

[-a <string>]

Adapter trimming. (1) “no”: no adapter trimming (default); (2) “fastx”: fastx adapter trimming; (3) “cutadapt”: cutadapt adapter trimming. If cutadapt is set, the “-Y” option should be specified in the command line

[-A <string>]

Adapter sequence (The default is Illumina adapter sequence:

AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG)

[-T <string>]

Quality trim flag. (1) “ no”: no quality trimming; (2) “brat”: brat dynamic trimming (default); (3) “fix”: fixed quality trimming

[-N <int>]

For fixed quality trimming (users specify the number of bases to be trimmed at the 5' end, default is 5)

[-n <int>]

For fixed quality trimming (users specify the number of bases to be trimmed at the 3' end, default is 10)

[-B <real>]

Cutoff value for selecting high bisulfite conversion regions (Range: [0, 1], default B=0.99)

[-b <real>]

Cutoff value for selecting low bisulfite conversion regions (Range: [0, 1], default b=0.6)

[-L <real>]

Cutoff value for selecting high coverage region (Range: [0, 1], default L=0.5)

[-l <real>]

Cutoff value for selecting low coverage region (Range: [0, 1], default l=0.1)

[-u <logic>]

Bisulfite flag (it is an option to initiate boxplot of high vs. low bisulfite rates, either ‘TRUE’ (default) or ‘FALSE’)

[-v <logic>]

Coverage flag (it is an option to initiate boxplot of high vs. low coverage, either ‘TRUE’ (default) or ‘FALSE’)

[-Y <string>]

Path to python when running cutadapt (i.e., python, python2.6, /home/bin/python)

[-Q <string>]

Path to FastQC (e.g., /home/appl/apps/bin/fastqc, default is to use the one complied in MethyQA pipeline)

[-M <string>]

Path to BRAT trim function (e.g., /home/appl/apps/bin/trim.v1.2.4, default is to use the one complied in MethyQA pipeline)

[-K <string>]

Path to BRAT-large function (e.g., /home/appl/apps/bin/brat-large.v1.2.4, default is to use the one complied in MethyQA pipeline)

[-J <string>]

Path to BRAT ACGT-count function (e.g., /home/appl/apps/bin/acgt-count.v1.2.4, default is to use the one complied in MethyQA pipeline)

[-X <string>]

Path to fastx function (e.g., home/appl/apps/bin/fastx, default is to use the one complied in MethyQA pipeline)

[-C <string>]

Path to cutadapt function (e.g., /home/appl/apps/bin/cutadapt, default is to use the one complied in MethyQA pipeline)