Skip to main content

Table 4 TOPSI signatures for B. mallei.

From: A high-throughput pipeline for the design of real-time PCR signatures

Chr. Forward primer
(position)
Probe
(position)
Reverse primer
(position)
Amplicon length
1 ACTGCTGTACCGCGCTCTTT
(2632348)
ATTCGCAGCACCCATTACAACCGTTG (2632376) GCTGAAGAGTGGCTGCAATG
(2632449)
121
1 GGTCTACAGCTCCGCGAATT
(3187456)
CTCAAACCGTTAGGCGACTCAAGGTGC
(3187488)
ATGGCATGGTGCTGTGAAAC
(3187528)
92
2 CGAGCCATCGACCTCATG (1094082) ACATGTCGAAGCATTTTTCGCCGC
(1094188)
TCGGCGATCGATGGTCTAG
(1094228)
165
2 CTCCCACGCCGACTGATAC
(1094844)
AAGCTGTTGATCGTGCAACACCAGCAC
(1094883)
CGGTGAAACCTGGATACTGGA
(1094938)
115
  1. The positions and amplicon lengths are with reference to the B. mallei ATCC 23344 genome.