Skip to main content

Table 2 Sample sequences recognized by each detector

From: A method for automatically extracting infectious disease-related primers and probes from the literature

Detector PMID Text String List of Tokens
1 19781080 ...primers AA247 (5'-TGCCATTGCCAAAGAGAC-3') and pLQ510-rp1... {"TGCCATTGCCAAAGAGAC"}
1 19664269 ...mecA gene, mecAR (5'-TTACTCATGCCATACATAAATGGATA-\n GACG-3') and mecAF... {"TTACTCATGCCATACATAAATGGATA", "GACG"}
1 19379498 ...specific primer pair traD-F (5'-caatgcttgatctatttggtag-3') and traD-R... {"caatgcttgatctatttggtag"}
1 19758438 ...MY 09, 5-CGT CCM\n ARR GGA WAC TGA TC-3; where M = A/C, W = A/T... {"CGT", "CCM", "ARR", "GGA", "WAC", "TGA", "TC"}
2 19799780 B-globin outside R @ CTC AAG TTC TCA GGA TCC A @ 1st round PCR primer for Human Beta globin DNA {"CTC", "AAG", "TTC", "TCA", "GGA", "TCC", "A"}
2 18847469 btherm @ GAT GTG CCG GGC TCC TGC ATG @ This study {"GAT", "GTG", "CCG", "GGC", "TCC", "TGC", "ATG"}
2 18154687 Stx1 @ GTA CGT CTT TAC TGA TGA TTG ATA GTG GCA CAG GG @ 35 @ 73.5 {"GTA", "CGT", "CTT", "TAC", "TGA", "TGA", "TTG", "ATA", "GTG", "GCA", "CAG", "GG"}
2 19558693 ...are listed below.\n
EP1- F ATG GTG GGC CAG CTT GTC\n
EP1- R...
{"ATG", "GTG", "GGC", "CAG", "CTT", "GTC"}
3 19754958 ...with primer N309 (ACATGCGGATCCCTCGAGCCTTTGAA-\nGATGACTAACTCCCCA) and N297... {" ACATGCGGATCCCTCGAGCCTTTGAA", "GATGACTAACTCCCCA"}
3 19737401 ...and 3' AAGCT TGGTA CCTCA CTGCA\nGCAGA GCGCT GAGGC CCAGC AGCAC. The resulting PCR... {"AAGCT", "TGGTA", "CCTCA", "CTGCA", "GCAGA", "GCGCT", "GAGGC", "CCAGC", "AGCAC"}
3 19149882 1 @ XAC0340 @ 432 @ gATACCCCATATgAATgCgAT {"gATACCCCATATgAATgCgAT"}
3 19775435 20 @ F:GAGATGGATTAACCAGATGTCTTAAAAACTATCGTAAC {":","GAGATGGATTAACCAGATGTCTTAAAAACTATCGTAAC"}
  1. This table shows some examples of sequences that can be recognized by each detector. The number under the column "Detector" identifies the detector that recognized the "List of Tokens" from the string "Text String" that can be found in the manuscript whose PubMed Identifier (PMID) is shown under the "PMID" column. The symbols /n and @ denote the newline and the table cell separator characters respectively.