Skip to main content

Table 5 Some examples of automated sequence refinement

From: A method for automatically extracting infectious disease-related primers and probes from the literature

List of Tokens

Execution Trace

Refined Singleton(s)

{"CATATTCACCTTTTCAGGCGTTTTGACCGT", "TAMRA", "T"}

<R2>

{"CATATTCACCTTTTCAGGCGTTTTGACCGT"}

{"ATAAC", "TCGAG", "GTGGA", "ATTCA", "TGGCA", "TCTAC", "TTCGT", "ATGAC", "TATTGC", "and", "AAGCT", "TGGTA", "CCTCA", "CTGCA", "GCAGA", "GCGCT", "GAGGC", "CCAGC", "AGCAC"}

<R5, R8, R8>

{"ATAACTCGAGGTGGAATTCATGGCATCTACTTCGTATGACTATTGC"},

{"AAGCTTGGTACCTCACTGCAGCAGAGCGCTGAGGCCCAGCAGCAC"}

{"than", "standard"}

<R4>

-

{"DNA"}

<R1>

-

{"TTCTTTTGGTGGACGATGTG", "and", "GAGGGACGC", "TTGGTAACG", "TAMRA", "and", "TCGCAAGCC", "AAGCAAATAC", "TAMRA", "T", "and", "GAGATAGGGTGCGATGGTTG", "TCGGCGATGACTACGACA"}

<R5, R3, R5, R5, R3, R8, R8, R8>

{"TTCTTTTGGTGGACGATGTG"},

{"GAGGGACGCTTGGTAACG"}, {"TCGCAAGCCAAGCAAATAC"},

{"GAGATAGGGTGCGATGGTTGTCGGCGATGACTACGACA"}

{"RNA", "strand"}

<R7, R1>

-

{":","GCGGCCTGATAAGGGATATTGGAAGC", "R", ":", "GGCGAAATTCATTAAAGAGGATCCTGACAC"}

<R3, R5>

{"GCGGCCTGATAAGGGATATTGGAAGC" }, {"GGCGAAATTCATTAAAGAGGATCCTGACAC" }

  1. This table shows the results of using the knowledge-based system to refine some sample lists of tokens produced by different recognizers in phase 2. Each row of the table presents the refinement process of a single list of tokens, including: (1) the initial contents of the facts base, (2) the execution trace and (3) the final state of the facts base. All singletons in the facts base at the end of the execution are considered as valid and refined sequences.