Skip to main content

Table 4 LAMP signature candidates for Mycobacterium tuberculosis, with gene targets based on the reference H37Rv genome [GenBank: NC_000962.2]. The hyphen in FIP and BIP sequences represents where the two segments should be linked together

From: LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification) DNA Signatures

Signature Size Gene Part Sequence Length
mTub228 275 bp Rv0987 F3 CGCTCTCAGTTTGATTGCCT 20 bp
    B3 CATTGCGAACATTGATGACA 20 bp
    FLoop CTCGGGTTACACCCAAACAG 20 bp
    BLoop CTTGATTGGAATTTGGCTCG 20 bp
    FIP GGATTCCGTCATTATCAGCCAAA-GACCGTTTTTCGCCATATTG 43 bp
    BIP CTGATTGGTACGGGCTTGGG-TGATGGTTTGAGTCACCAGG 40 bp
mTub229 195 bp Rv0988 F3 AATGGCACCGCTTTGATG 18 bp
    B3 AATTTCGATTTCCCATGCAA 20 bp
    FLoop CTGGAAAATCGGGTCACACT 20 bp
    BLoop ATTTCCGCATCAAGACGACT 20 bp
    FIP CATCCCCGGCAACAAAGGTA-TTTTCAGATTCGACAGGCG 39 bp
    BIP GTGATCCCTCTCGAGTCGTCC-CACTCTGGTCACTGGTCCAA 41 bp
mTub230 252 bp Rv1290c F3 GACACCACGATCAGCACG 18 bp
    B3 CGTAGTTCCGCCTAGTGCTC 20 bp
    FLoop GTCGATGATTCCCGTGAAAT 20 bp
    BLoop ACGGTTGAGCATGCTGGT 18 bp
    FIP AGTCTGGGTGCTGCCGACAT-GCCCTGAAACATCAGCTTGT 40 bp
    BIP CGCCCTGTAAGTAATCCAGTATGG-GGATGGGTGCATGCTTATTC 44 bp
mTub231 235 bp tyrS
(approx)
F3 GATTGGGAGGTGATGAGACC 20 bp
    B3 CTAGTCGTGGGATACCAGCG 20 bp
    FLoop CGTACTCGATCCCGTTGTTC 20 bp
    BLoop TGCGTTGTAGTCGATTTCCA 20 bp
    FIP TCACACGCACAGCTGTTTAGTGA-TAGTGCGTTGACCTCACTCG 43 bp
    BIP CATCATCCTTTCATGTGACAGGC-CCGCCAAAGATAAGTCAGGA 43 bp
mTub232 230 bp Rv2735c and recX F3 CGGTCTATGTTCTCGGGCT 19 bp
    B3 GTGGGTACGGCCAGACCT 18 bp
    FLoop GCCTTCAACAGGGCTAGTCA 20 bp
    BLoop CATCGAATCCCTTTAGACGC 20 bp
    FIP AACAAACTGGAGATACTTGCCGG-GTCGAGGTAAATTCGTTCACG 44 bp
    BIP CGCGTCCAATATGACCATTCTCTA-GTGGTTATCGCCGAGCTG 42 bp