Figure 1

Experimental results for DO50 and DO60 assays. qPCR of DO50 and DO60 DNA using sequence selective assays for DO50 and DO60. qPCR was performed using a Bio-Rad iCycler MyiQTM Real-Time Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The selective primers for the DO50 and DO60 assays are DO-50 F1 (ATCGGCCTCACAAA) and DO-50R1 (TAACCAATTCCTTGTTGTT) and DO-60 F2 (AGCGAAACCCTCTCA) and DO-60R2 (TACGAGTTGTCGCAATAC), respectively. The selective probes for the DO50 and DO60 assays are DO-50Probe-1, [6-FAM]AACAGCACAGTGGACCTGCC[BHQ1a-6FAM] and DO-60Probe-2, [6-FAM]AAAGCTAGCGGGCACAGGC[BHQ1a-6FAM], respectively, where BHQ1a is Black Hole Quencher 1 (Eurofins MWG Operon, Huntsville, AL, USA). The targets are fragments of the ITS rRNA gene with sizes of 94-bp and 75-bp for DO50 and DO60, respectively. The thermal cycling conditions were 94°C for 5 minutes; 42 cycles of 94°C for 20 seconds, X°C for 30 seconds and 72°C for 30 seconds; followed by 72°C for 10 minutes; where X = 58.3 for DO50 and 63 for DO60. Amplification reactions were performed in iCycler iQ PCR Plates with Optical Flat 8-Cap Strips (Bio-Rad Laboratories). PCRs were performed in 25-μl reactions containing the following reagents: 50 mM Tris (pH 8.3), 500 μg/ml bovine serum albumin (BSA), 2.5 mM MgCl₂, 250 mM of each dNTP, 400 nM of each primer, 250 nM of the probe, 8.36 x 10⁶ copies of the ITS rRNA gene, and 1.25 units of Taq DNA polymerase. Ct = threshold cycle. Error bars indicate standard error. n = 4 for each column.