Skip to main content

Table 2 Primer sequences:

From: Oliz, a suite of Perl scripts that assist in the design of microarrays using 50mer oligonucleotides from the 3' untranslated region

Rn.10936 Growth hormone – releasing receptor
   5' primer TGCACTCAAACTGCCATGCC
   3' primer TCCCCTTCAGAGCCACATTGAC
Rn.29258 ATP synthase, H+ transporting
   5' primer CAACTCTTCTCCTATGCGATTC
   3' primer TTTGTCTTCTCTCTGTCAAACC
Rn.2401 cysteine rich protein
   5' primer AAGGGAGAGCCTAATGAATACC
   3' primer TGATAAATCAGCTTCAACAGCC
Rn.38641 Recoverin
   5' primer GTGAAGGGAAGGATAAAGGAAAAG
   3' primer TGGGATTATCACAGGGCTAC
Rn.10573 nitrix oxide synthase 1, neuronal
   5' primer TTGACTAAATTCGGACACACACG
   3' primer AGGAAGAAGGACCAGGACAC