Skip to main content

Table 1 Coverage and amplicon characteristics for the adjacent Weisburg and Lane universal primer sets in 47,257 bacterial sequences.

From: Bacterial genotyping by 16S rRNA mass cataloging

Forward Primer Reverse Primer Occurrence of Primer Pair in All Bacterial Sequences Occurrence of Primer Pair in Enteric Sequences Average Amplicon Length and Std. Dev. (All Bacteria) Average Amplicon Length and Std. Dev. (Enterics only)
"Weisburg FWD" AGAGTTTGATCCTGGCTCAG AGAGTTTGATCATGGCTCAG AGAGTTTGATCCTGGCTTAG AGAATTTGATCTTGGTTCAG "Lane A" CAGCAGCCGCGGTAATAC CAGCAGCCGCGGTAATTC CAGCCGCCGCGGTAATAC CAGCCGCCGCGGTAATTC 9337/47257 = 19.76% 333/1655 = 20.12% 518.78 ± 37.94 bp 530.42 ± 3.38 bp
"Lane A" CAGCAGCCGCGGTAATAC CAGCAGCCGCGGTAATTC CAGCCGCCGCGGTAATAC CAGCCGCCGCGGTAATTC "Lane B" AAACTCAAAGGAATTGACGG AAACTCAAATGAATTGACGG AAACTTAAAGGAATTGACGG AAACTTAAATGAATTGACGG 38310/47257 = 81.07% 1553/1655 = 93.84% 408.83 ± 7.35 bp 409.17 ± 2.40 bp
"Lane B" AAACTCAAAGGAATTGACGG AAACTCAAATGAATTGACGG AAACTTAAAGGAATTGACGG AAACTTAAATGAATTGACGG "Lane C" GTACACACCGCCCGT GCACACACCGCCCGT 36,058/47,257 = 76.30% 1401/1655 = 84.65% 500.83 ± 13.94 bp 501.26 ± 1.06 bp
"Lane C" GTACACACCGCCCGT GCACACACCGCCCGT "Weisburg REV" GGTTGGATCACCTCCTTA AAGTCGTAACAAGGTAACCGT AAGTCGTAACAAGGTAGCCGT AAGTCGTAACAAGGTATCCGT 9991/42257 = 21.14% 373/1655 = 22.54% 123.62 ± 57.24 bp 122.24 ± 8.1978 bp