An accurate and interpretable model for siRNA efficacy prediction

BMC Bioinformatics

Table 7 List of siRNA with bad predictions.

Id	Target	Target site	M.A.	P.A.	status	ΔG_loc	s.d	begin	end
1	NM_012864	CAGGCGCAGAAUUAUCUUAGG	1.341	0.765	under	-17	2.86	63	83
9		GUUUGCCGGAGACUGGAAAGC	0.019	0.373	over	-18.2	5.75	163	183
2	NM_017346	AUCGAGCGCUCCAACACUCGC	0.152	0.684	over	-19.9	0.00	831	851
3		UGACGCCACCUCAGGGCACCU	0.086	0.563	over	-17.7	0.00	209	229
11	NM_002559	UGCGUGAACUACAGCUCUGUG	0.420	0.743	over	-4.8	0.00	376	396
15		AGCUCUGUGCUCCGGACCUGU	0.419	0.713	over	-29.8	0.00	388	408
4	NM_003342	GGGAAGUCCUUAUUAUUGGCC	0.876	0.435	under	-17.9	0.06	69	89
5		UUCCUGAGCUGGAUGGAAAGA	1.201	0.799	under	-2.4	0.98	246	266
7	NM_016406	GUGGCAAAAUAUGCCUGACGG	0.999	0.616	under	-10.4	0.00	285	305
22		AUGCCUGACGGAUCAUUUCAA	1.173	0.907	under	-8.8	2.12	295	315
6	NM_003340	UUCUUUUAUCCAUUUGUUCAC	0.270	0.672	over	-7.2	1.41	255	275
8	NM_003347	UAUGAUAAGGGAGCCUUCAGA	1.099	0.728	under	-8.3	0.06	86	106
10	NM_018426 (XM_371822)	GAUGCCACCCGACGCCCUCAC	0.127	0.454	over	-9.5	1.18	2148	2168
12	NM_001009264 (XM_214061)	CCAGGGCGGAGAAGGCCGACG	0.239	0.548	over	-25.1	0.00	371	391
14		UGAACUUUGGGUCCCUGUGAC	0.268	0.568	over	-11.1	0.00	865	885
16	NM_001001481	UGUAACAAGAAUCCAAAGAAA	1.146	0.853	under	-10.9	0.19	353	373
17	NM_016021	CAACAAAAGGAGAGGGAGCCA	0.417	0.709	over	-19.7	0.00	309	329
18	NM_022005	CCUGUGACCUCCAUCUACUCU	0.968	0.682	under	-16.5	0.00	79	99
19	NM_007019	UGUAUGAUGUCAGGACCAUUC	0.321	0.601	over	-10.1	1.02	185	205
20	NM_006357	UAAAGGAGAUAACAUUUAUGA	0.520	0.795	over	-9.6	0.00	211	231

This table gives the list of siRNAs for which the discrepancy between the prediction and the actual potency were particularly large. Each siRNA sequence has been arbitrarily named from 1 to 22. Two sequences have been discarded because their target sequences have been modified in Genbank since Huesken's publication date. M.A. is the measured activity as given in Huesken et al. [33]. P.A. is the predicted activity according to our LASSO model. The column status refers to the activity of the siRNA that has been over- or under-predicted compared to the activity measured experimentally. The begin and end columns indicate the position of the siRNA guide strand within the target sequence. The ΔG_loccorresponds to the mean local free energies of motifs in which nucleotides of the target sequence are involved for the 10 lowest energy structures and is given in kcal/mol. s.d. represents the standard deviation of each mean ΔG_loccomputed.

ISSN: 1471-2105