Skip to main content

Advertisement

Table 7 List of siRNA with bad predictions.

From: An accurate and interpretable model for siRNA efficacy prediction

Id Target Target site M.A. P.A. status ΔG loc s.d begin end
1 NM_012864 CAGGCGCAGAAUUAUCUUAGG 1.341 0.765 under -17 2.86 63 83
9   GUUUGCCGGAGACUGGAAAGC 0.019 0.373 over -18.2 5.75 163 183
2 NM_017346 AUCGAGCGCUCCAACACUCGC 0.152 0.684 over -19.9 0.00 831 851
3   UGACGCCACCUCAGGGCACCU 0.086 0.563 over -17.7 0.00 209 229
11 NM_002559 UGCGUGAACUACAGCUCUGUG 0.420 0.743 over -4.8 0.00 376 396
15   AGCUCUGUGCUCCGGACCUGU 0.419 0.713 over -29.8 0.00 388 408
4 NM_003342 GGGAAGUCCUUAUUAUUGGCC 0.876 0.435 under -17.9 0.06 69 89
5   UUCCUGAGCUGGAUGGAAAGA 1.201 0.799 under -2.4 0.98 246 266
7 NM_016406 GUGGCAAAAUAUGCCUGACGG 0.999 0.616 under -10.4 0.00 285 305
22   AUGCCUGACGGAUCAUUUCAA 1.173 0.907 under -8.8 2.12 295 315
6 NM_003340 UUCUUUUAUCCAUUUGUUCAC 0.270 0.672 over -7.2 1.41 255 275
8 NM_003347 UAUGAUAAGGGAGCCUUCAGA 1.099 0.728 under -8.3 0.06 86 106
10 NM_018426 (XM_371822) GAUGCCACCCGACGCCCUCAC 0.127 0.454 over -9.5 1.18 2148 2168
12 NM_001009264 (XM_214061) CCAGGGCGGAGAAGGCCGACG 0.239 0.548 over -25.1 0.00 371 391
14   UGAACUUUGGGUCCCUGUGAC 0.268 0.568 over -11.1 0.00 865 885
16 NM_001001481 UGUAACAAGAAUCCAAAGAAA 1.146 0.853 under -10.9 0.19 353 373
17 NM_016021 CAACAAAAGGAGAGGGAGCCA 0.417 0.709 over -19.7 0.00 309 329
18 NM_022005 CCUGUGACCUCCAUCUACUCU 0.968 0.682 under -16.5 0.00 79 99
19 NM_007019 UGUAUGAUGUCAGGACCAUUC 0.321 0.601 over -10.1 1.02 185 205
20 NM_006357 UAAAGGAGAUAACAUUUAUGA 0.520 0.795 over -9.6 0.00 211 231
  1. This table gives the list of siRNAs for which the discrepancy between the prediction and the actual potency were particularly large. Each siRNA sequence has been arbitrarily named from 1 to 22. Two sequences have been discarded because their target sequences have been modified in Genbank since Huesken's publication date. M.A. is the measured activity as given in Huesken et al. [33]. P.A. is the predicted activity according to our LASSO model. The column status refers to the activity of the siRNA that has been over- or under-predicted compared to the activity measured experimentally. The begin and end columns indicate the position of the siRNA guide strand within the target sequence. The ΔG loc corresponds to the mean local free energies of motifs in which nucleotides of the target sequence are involved for the 10 lowest energy structures and is given in kcal/mol. s.d. represents the standard deviation of each mean ΔG loc computed.