Skip to main content

Table 5 RepeatMasker, STAR, Mreps, TRF and Sputnik detections between starting positions 532800 and 53500 in the human X chromosome.

From: Detecting microsatellites within genomes: significant variation among algorithms

  start end divergence motif sequence
RepeatMasker      
  531688 531713 0 AAT AATAATAATAATAATAATAATAATAA
  532355 532540 15.05 TTCC TTCCTTCCTCCCTTCCTTCCTTCCTTTCTTCTTTCTTTCTTTCCTTCCTTCCTGCTTTCCTTCCTTCC
      TTTCTTTTCTTTCTTTCCTTCCTTCCTTGCTTCCTTCCTTCCATCTTTCTCTTTCTCTTTTTCTTTCT
      TTCTCTCCTTCCTTCTTTCCTTCCTTCCTTCCCTTCCCTTCCTTCCTTCC
  532704 532891 15.87 TTCC CCTTCCTTCCTTTCTTCTTTCTTTCCTTCCTTCCTTGCTTCCTTCCTTCCATCTTTCTTTCTTTCTTT
      CTTCCTCTCCTTCCTTCTTTCCTTCCTTCCTTCCCTTCCCTCCTTCCTTTTTCTTCTTCTCTTTCTTT
      CTTTCTCTTTCCTTCCTTCCTTCCTTCTTTCTCCTTCCTTCCTTCTTTCCTT
STAR      
  531688 531713 0 AAT AATAATAATAATAATAATAATAATAA
  532537 532731 25.38 TTTTTC TTCCTTTTTCTTCTTCTCTTTCTTTCTTTCTTTTTCTTTCCTTCCTTCCTTCTTTCTCCTTCCTTCCT
      TCCATTTTTCTTTCTTTCTTTCTTTCTTTCTCTCTCTCTCTTTCTTTCTTTCTCTCTCTCTCTTCTTC
      CTTCCTTCCTTCCATTCTTCTTTCTTTCTTTCCTTCCTTCCTTTCTTCTTTCTTTCCTT
Mreps      
  531688 531715 3.45 AAT AATAATAATAATAATAATAATAATAAAA
  532330 532429 15.84 TTCC TTTCCTTCTTTCTTTCTTACTTTCTTTCCTTCCTCCCTTCCTTCCTTCCTTTCTTCTTTCTTTCTTTC
      CTTCCTTCCTGCTTTCCTTCCTTCCTTTCTTT
  532428 532467 12.5 TTCC TTTCTTTCTTTCCTTCCTTCCTTGCTTCCTTCCTTCCATC
  532466 532490 4 TTTCTC TCTTTCTCTTTCTCTTTTTCTTTCT
  532491 532524 11.76 TTCC TTCTCTCCTTCCTTCTTTCCTTCCTTCCTTCCCT
  532525 532542 5.56 TTCC TCCCTTCCTTCCTTCCTT
  532551 532593 13.95 TTTC TCTCTTTCTTTCTTTCTTTTTCTTTCCTTCCTTCCTTCTTTCT
  532593 532609 5.88 TTCC TCCTTCCTTCCTTCCAT
  532609 532667 16.95 TC TTTTTCTTTCTTTCTTTCTTTCTTTCTCTCTCTCTCTTTCTTTCTTTCTCTCTCTCTCT
  532667 532689 8.7 TTCC TTCTTCCTTCCTTCCTTCCATTC
  532690 532756 11.94 TTCC TTCTTTCTTTCTTTCCTTCCTTCCTTTCTTCTTTCTTTCCTTCCTTCCTTGCTTCCTTCCTTCCATC
  532755 532777 4.35 TTTC TCTTTCTTTCTTTCTTTCTTCCT
  532776 532820 8.89 TTCC CTCTCCTTCCTTCTTTCCTTCCTTCCTTCCCTTCCCTCCTTCCTT
TRF {2,7,7;20}      
  531688 531713 0 AAT AATAATAATAATAATAATAATAATAA
  532313 532330 5.26 TTTTC TTTTCTTTTCTTTCTTTT
  532423 532438 5.88 TTTTC TTTCTTTTCTTTCTTT
  532466 532490 4 TTTCTC TCTTTCTCTTTCTCTTTTTCTTTCT
  532544 532553 0 TTC TTCTTCTTCT
  532550 532576 13.79 TTTCTC TTCTCTTTCTTTCTTTCTTTTTCTTTC
  532633 532667 8.57 TC TCTCTCTCTCTCTTTCTTTCTTTCTCTCTCTCTCT
Sputnik {1,-6,7}      
  531568 531576 0 ACC ACCACCACC
  531688 531711 0 AAT AATAATAATAATAATAATAATAAT
  531849 531856 0 TTGC CTTGCTTG
  531893 531900 0 TG TGTGTGTG
  531927 531934 0 ATGC TGCATGCA
  532078 532085 0 AGGC GCAGGCAG
  532266 532273 0 ATGC TGCATGCA
  532313 532322 0 TTTTC TTTTCTTTTC
  532335 532354 5 TTTC TTCTTTCTTTCTTACTTTCT
  532355 532422 10.29 TTCC TTCCTTCCTCCCTTCCTTCCTTCCTTTCTTCTTTCTTTCTTTCCTTCCTTCCTGCTTTCCTTCCTTCC
  532423 532439 5.88 TTTC TTTCTTTTCTTTCTTTC
  532440 532463 4.17 TTCC CTTCCTTCCTTGCTTCCTTCCTTC
  532466 532489 4.17 TTTCTC TCTTTCTCTTTCTCTTTTTCTTTC
  532500 532541 7.14 TTCC TCCTTCTTTCCTTCCTTCCTTCCCTTCCCTTCCTTCCTTCCT
  532544 532552 0 TTC TTCTTCTTC
  532553 532568 0 TTTC TCTTTCTTTCTTTCTT
  532569 532576 0 TTTC TTTCTTTC
  532577 532588 0 TTCC CTTCCTTCCTTC
  532596 532607 0 TTCC TTCCTTCCTTCC
  532615 532656 7.14 TTTC TTTCTTTCTTTCTTTCTTTCTCTCTCTCTCTTTCTTTCTTTC
  532657 532666 0 TC TCTCTCTCTC
  532669 532684 0 TTCC CTTCCTTCCTTCCTTC
  532687 532692 0 TTC TTCTTC
  532693 532704 0 TTTC TTTCTTTCTTTC
  532705 532752 8.33 TTCC CTTCCTTCCTTTCTTCTTTCTTTCCTTCCTTCCTTGCTTCCTTCCTTC
  532755 532774 0 TTTC TCTTTCTTTCTTTCTTTCTT
  532780 532820 7.32 TTCC CCTTCCTTCTTTCCTTCCTTCCTTCCCTTCCCTCCTTCCTT
  1. Resolution of Mreps was set to 1, threshold alignment score of TRF to 20 and alignment weights of TRF to {2,7,7}. Sputnik mismatch penalty and validation score were set to -6 and 7, respectively. The number of detections varies with algorithms (from 3 to 18). Moreover, the sequence information is dealt with in different ways; an example is the region of cryptic simplicity between positions 532815 and 533080. RepeatMasker and STAR decompose it into large, distant and highly imperfect detections, though not the same for the two algorithms. Mreps returns a succession of shorter detections, overlapping the whole region. TRF detects only short, not much divergent, subregions, which do not completely overlap with the whole region. Sputnik detections are very numerous, short and slightly divergent, but overlap the whole region. Detection of compound microsatellites by Mreps is illustrated at position 533706, where other algorithms detect only a perfect polyA strech. The detection at position 534186 is returned as two detections by Mreps, because the two consecutive errors (insertions of G and C) stop the detection when resolution is set to 1. Very short hexanucleotides (12 bp) are detected by both TRF and Sputnik at positions 533138 and 534112. Most detections of Sputnik are two-repeat tetranucleotides, or three-repeat trinucleotides, which cannot be detected by other algorithms.