AffyMAPSDetector: a software tool to characterize Affymetrix GeneChip™ expression arrays with respect to SNPs

BMC Bioinformatics

Table 1 Sample of SNP Detection output from AffyMAPSDetector.

Probeset	X	Y	Gene ID	Locus Link	Range Min	Interrogation	Middle Position	Range Max	Probe Sequence
1260_s_at	451	467	M16594	2939	500	512	512	524	AAGACTACCTTGTTGGCAACAAGCT
1261_i_at	348	549	M16595	2939	872	884	884	896	TACAACTCCTATTCACCCACTTAGT
1341_at	499	313	X52056	6688	774	575	786	798	AGGACAAGGGCACCTTCCAGTTCTC
1347_at	341	471	S78187	994	2955	2967	2967	2979	GTCACAGAAGCAGCTAAACCAAGGA

A subset of SNP detection output file generated by AffyMAPSDetector run on HG-U95Av2. Some of the columns have been omitted for brevity. Range Min is the where the probe starts on the transcript and Range Max is where it ends. Row 4 shows an instance where the interrogation position differs from the mismatch (middle) position.

ISSN: 1471-2105