Skip to main content
Figure 12 | BMC Bioinformatics

Figure 12

From: An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutions

Figure 12

Output Screen of a Rearranging Mutation in Artificial Example II. Output screen of our procedure for a rearranging 3-point mutation with the secondary structure drawings for the wild-type and the mutant, including additional measures (the example is for the sequence CCGGAAGAGGGGGACAACCCGGGGAAACUCGGGCUAAUCCCCCAUGUGGACCCGCCCCUUGGGGUGUGUCCAAAGGGCUUUGCCCGCUUCCGG).

Back to article page

BMC Bioinformatics

ISSN: 1471-2105

Contact us