Figure 8From: An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutionsOutput Screen of a Rearranging Mutation in Artificial Example I. Output screen of our procedure for the rearranging mutation A15G-U20G with the secondary structure drawings for the wild-type and the mutant, including additional measures (the example is for the sequence CCUUAACCAGCAAAAACUGCUGG).Back to article page