Skip to main content

Table 1 List of specific (G1) and single (S1) pairs of primers for in vitro validation

From: TipMT: Identification of PCR-based taxon-specific markers

Group Species Primer Name Sequence Forward (5’ - > 3’) Sequence Reverse
(5’ - > 3’)
Amplicon
(pb)
G1 L. amazonensis Lam.A480-1 GCGCGCGAGAAAATAGAGAC GGGCGTCGTCGATATCTGTT 379
L. braziliensis LbrM.11.1130-0 ACAGAACAATCAGGCCCGAG GCTATCGGACGCCTCATCAA 244
L. infantum LinJ.36.1330-0 AGTTCCTTTGTTGTTGTGTTTCGT TTATCTCTCCCGTCCCTCCG 334
S1 L. infantum, L. braziliensis and L. major LmjF29-1 GCGGTGCTTGAATCACGTTT GCGGTGTTTACATGACGACG 307-322-337
  1. All primers were generated by TipMT on “Ortholog target” mode using L. amazonensis, L. braziliensis and L. infantum genomes (G1 primers), or L. braziliensis, L. major and L. infantum genomes (S1 primers)