Fig. 9
From: SplicedFamAlign: CDS-to-gene spliced alignment and identification of transcript orthology groups
Toy example of a gene sequence g with nucleotides numbered by position from 1 to 63, and a set of two CDS \(\mathcal {C}(g)= \{c_{1},c_{2}\}\) such that c1={(9,12),(18,29), (49,56)} and c2={(4,12),(18,23),(35,43),(49,60)}, inducing a set of exons \(\mathcal {E}(g)=\{(4,12), (9,12), (18,23), (18,29), (35,43), (49,56), (49,60)\}\). The sequence of the CDS c1 is g[c1]=ATGCAAGCAGGTCTGGGGGAATGA with a set of exons \(\mathcal {E}(g[c_{1}]) = \{(1,4), (5,16), (17,24)\}\). The first exon of the CDS sequence g[c1] is (1,4) with exon sequence g[c1][1,4]=ATGC