Skip to main content

Table 1 List of primers designed by AutoCloner to amplify and sequence TraesCS5A01G531300 in Apogee. Oligo names succeeded by an F are forward primers, whilst an R indicates a reverse primer. Both primers for PCR and primers for Sanger sequencing are included

From: AutoCloner: automatic homologue-specific primer design for full-gene cloning in polyploids

Oligo Name Sequence (5′- > 3′) Type
T.300.577–1989.F AGACTTCCTGAACACGGCACAA PCR
T.300.577–1989.R CTTCTTGATGGCGCGGCATATAT PCR
T.300.1904–3138.F TAGGTTGACGTCATCGAAGCAG PCR
T.300.1904–3138.R CGGGTGAGAAGCAAGGACTC PCR
T.300.2632–3437.F CCATGGTGAGGTTGAGGTCC PCR
T.300.2632–3437.R GGTGCAGCAAGAGTACGGAG PCR
T.300.2888–4219.F CGGACGATGACAACAGGGAG PCR
T.300.2888–4219.R CCCTGCTCTCTCTCTCTCTCT PCR
T.300.577–1989.split2.F CTCGAACTCGCTATTGGGCT Sanger
T.300.577–1989.split3.F AGTCAAGGTACAATATGTGACTGA Sanger
T.300.1904–3138.split2.F CCGTGAAGTACCGAAACCCA Sanger
T.300.1904–3138.split3.F TAACGAACCTGGTGCCTTCG Sanger
T.300.2632–3437.split2.F TCAGGTCCTTGGCCAGTTTC Sanger
T.300.2888–4219.split2.F GTGGAGACATGGAGGAGCAC Sanger
T.300.2888–4219.split3.F ACCAACACTCAAGCAAAGGGA Sanger