Skip to main content

Table 3 Information of a DR array on ‘NC_022132.1’ genome

From: CrisprVi: a software for visualizing and analyzing CRISPR sequences of prokaryotes

No Start position Sequence Length
1 1463293 AACCGATTCTCTTTTTAAATTTCTTTATGGTAAAATA 37
2 1463359 GTTTTAGTCTCTTTTTAAATTTCTTTATGGTAAAATG 37
3 1463425 GTTTTAGTCTCTTTTTAAATTTCTTTATGGTAAAATA 37
4 1463491 GTTTTAGTCTCTTTTTAAATTTCTTTATGGTAAAATA 37
5 1463557 GTTTTAGTCTCTTTTTAAATTTCTTTATGGTAAAATA 37